ID: 935137579_935137586

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 935137579 935137586
Species Human (GRCh38) Human (GRCh38)
Location 2:100321517-100321539 2:100321561-100321583
Sequence CCGGGAAGCACTTCTCCAGCAGG CGCCGCACCTGCGGCCGCGCGGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 11, 3: 26, 4: 234} {0: 1, 1: 0, 2: 3, 3: 13, 4: 189}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!