ID: 935153762_935153763

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 935153762 935153763
Species Human (GRCh38) Human (GRCh38)
Location 2:100463867-100463889 2:100463904-100463926
Sequence CCTACATCTGTACATACATAACT TTTAAAACTTTTACATAAGTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!