ID: 935167556_935167570

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 935167556 935167570
Species Human (GRCh38) Human (GRCh38)
Location 2:100582446-100582468 2:100582490-100582512
Sequence CCCCAAAAAAAGGCCGGGTGCGG GCACTTTGGGAGGCCAAGGCGGG
Strand - +
Off-target summary No data {0: 56485, 1: 171609, 2: 226607, 3: 184242, 4: 115036}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!