ID: 935183930_935183934

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 935183930 935183934
Species Human (GRCh38) Human (GRCh38)
Location 2:100714847-100714869 2:100714897-100714919
Sequence CCTGTAGGATTTTGGAGCAAGGC TCCTTTTGACAGACAGCTCTTGG
Strand - +
Off-target summary {0: 4, 1: 162, 2: 205, 3: 172, 4: 246} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!