ID: 935216967_935216973

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 935216967 935216973
Species Human (GRCh38) Human (GRCh38)
Location 2:100982293-100982315 2:100982335-100982357
Sequence CCTGCAGGCCAATATCCGGTGGC GATCCAGGAGCAGCTCTGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 92} {0: 1, 1: 0, 2: 4, 3: 46, 4: 334}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!