ID: 935220666_935220667

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 935220666 935220667
Species Human (GRCh38) Human (GRCh38)
Location 2:101009653-101009675 2:101009699-101009721
Sequence CCAGCACAGTAGACGAGCAGCAT TAATCCCACAAGATGTTTTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 43} {0: 1, 1: 1, 2: 1, 3: 12, 4: 157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!