ID: 935225426_935225435

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 935225426 935225435
Species Human (GRCh38) Human (GRCh38)
Location 2:101048094-101048116 2:101048117-101048139
Sequence CCATGTGCCCCACACACACAGGG AGAGGGGGAGAAGCTTCAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 43, 4: 372} {0: 1, 1: 0, 2: 1, 3: 17, 4: 281}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!