ID: 935239025_935239034

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 935239025 935239034
Species Human (GRCh38) Human (GRCh38)
Location 2:101162151-101162173 2:101162199-101162221
Sequence CCAGGCACTCCTCTCTGGAGAAA ATGAGGGAGCAGAACTAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 252} {0: 1, 1: 0, 2: 0, 3: 28, 4: 282}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!