|
Left Crispr |
Right Crispr |
| Crispr ID |
935239961 |
935239966 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:101169658-101169680
|
2:101169697-101169719
|
| Sequence |
CCAGCCACGTGGAACCGTGAGTC |
TTTTATAAATTGCCCAGTCTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 11, 1: 635, 2: 4748, 3: 7908, 4: 8118} |
{0: 63, 1: 1386, 2: 5271, 3: 5350, 4: 3641} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|