|
Left Crispr |
Right Crispr |
Crispr ID |
935239961 |
935239967 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
2:101169658-101169680
|
2:101169698-101169720
|
Sequence |
CCAGCCACGTGGAACCGTGAGTC |
TTTATAAATTGCCCAGTCTTGGG |
Strand |
- |
+ |
Off-target summary |
{0: 11, 1: 635, 2: 4748, 3: 7908, 4: 8118} |
{0: 125, 1: 3745, 2: 13076, 3: 15273, 4: 11785} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|