ID: 935259738_935259760

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 935259738 935259760
Species Human (GRCh38) Human (GRCh38)
Location 2:101344043-101344065 2:101344096-101344118
Sequence CCGGCTCCTGCCCACATCCAGGC CAGGGCAGGCAGGAGGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 72, 4: 617} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!