ID: 935265994_935265999

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 935265994 935265999
Species Human (GRCh38) Human (GRCh38)
Location 2:101394788-101394810 2:101394808-101394830
Sequence CCTTCTTTTTTTTTTTTTTTCCG CCGGACAGGGCCTCGCTCTGTGG
Strand - +
Off-target summary {0: 1, 1: 69, 2: 1236, 3: 13992, 4: 56853} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!