ID: 935309049_935309053

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 935309049 935309053
Species Human (GRCh38) Human (GRCh38)
Location 2:101764985-101765007 2:101765030-101765052
Sequence CCATTATCAGATGGTCCAAAAAA CAAGGTAAACTTGAGGATAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 371} {0: 1, 1: 0, 2: 1, 3: 13, 4: 218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!