ID: 935315324_935315326

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 935315324 935315326
Species Human (GRCh38) Human (GRCh38)
Location 2:101827730-101827752 2:101827751-101827773
Sequence CCATGTTCACATTCCACATGGCA CAGTATCTTCATATTGAACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 209} {0: 1, 1: 0, 2: 2, 3: 33, 4: 485}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!