ID: 935315560_935315563

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 935315560 935315563
Species Human (GRCh38) Human (GRCh38)
Location 2:101830229-101830251 2:101830281-101830303
Sequence CCAGAATGTAAATTCTGGGAATG CATTGTGACTTCATTGTAGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 224} {0: 1, 1: 0, 2: 1, 3: 19, 4: 182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!