ID: 935332267_935332279

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 935332267 935332279
Species Human (GRCh38) Human (GRCh38)
Location 2:101985844-101985866 2:101985891-101985913
Sequence CCTGGCCCGGGGTGATGAGGGTA CTAATACCCAGAGCGGTCGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 189} {0: 1, 1: 0, 2: 0, 3: 4, 4: 28}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!