ID: 935344954_935344960

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 935344954 935344960
Species Human (GRCh38) Human (GRCh38)
Location 2:102099338-102099360 2:102099351-102099373
Sequence CCAGTGGCCTTTGTTTGAGTTCT TTTGAGTTCTTCCAGGGATGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 220} {0: 1, 1: 0, 2: 1, 3: 18, 4: 326}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!