ID: 935348356_935348364

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 935348356 935348364
Species Human (GRCh38) Human (GRCh38)
Location 2:102130441-102130463 2:102130490-102130512
Sequence CCCTCACTCTTATCTTTCCTCTT ACTCTTGGTGGCACAAGCTTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 118, 4: 1153} {0: 1, 1: 0, 2: 0, 3: 3, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!