ID: 935357022_935357030

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 935357022 935357030
Species Human (GRCh38) Human (GRCh38)
Location 2:102210804-102210826 2:102210855-102210877
Sequence CCAGAGTAGGTCATGGCCTGTAT GACATGACCTTCAAAGTCATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 68} {0: 1, 1: 0, 2: 3, 3: 12, 4: 133}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!