ID: 935384842_935384848

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 935384842 935384848
Species Human (GRCh38) Human (GRCh38)
Location 2:102489179-102489201 2:102489199-102489221
Sequence CCTAAAGTCATTTGCTCCAAATT ATTGATGTGGGGAGTGAAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 291} {0: 1, 1: 0, 2: 2, 3: 45, 4: 410}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!