ID: 935406843_935406852

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 935406843 935406852
Species Human (GRCh38) Human (GRCh38)
Location 2:102718554-102718576 2:102718603-102718625
Sequence CCGAGAGGAGAGGGGCGATGATG CACGCCAATAAGGGTGCCGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 152} {0: 1, 1: 0, 2: 0, 3: 1, 4: 28}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!