ID: 935425106_935425113

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 935425106 935425113
Species Human (GRCh38) Human (GRCh38)
Location 2:102911308-102911330 2:102911356-102911378
Sequence CCACCAAAGCCCAGTAACAGGCC AGTTATTTGCAGAAGATGGCAGG
Strand - +
Off-target summary {0: 144, 1: 161, 2: 86, 3: 68, 4: 218} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!