ID: 935425111_935425115

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 935425111 935425115
Species Human (GRCh38) Human (GRCh38)
Location 2:102911329-102911351 2:102911379-102911401
Sequence CCAAGAGCTGTATCTCAAAAGGA GCCTTGCTCCAAAATTCTAGAGG
Strand - +
Off-target summary {0: 2, 1: 197, 2: 233, 3: 184, 4: 287} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!