ID: 935437954_935437966

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 935437954 935437966
Species Human (GRCh38) Human (GRCh38)
Location 2:103056898-103056920 2:103056939-103056961
Sequence CCCCTAGTCACGGCACTCTCCCT ATCCAAGCTGCATGGGGAGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 1, 3: 11, 4: 256}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!