ID: 935466701_935466705

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 935466701 935466705
Species Human (GRCh38) Human (GRCh38)
Location 2:103406571-103406593 2:103406621-103406643
Sequence CCTTCCTGAGAAGCTCTTGTGAG CCATTCACTCAGTGTGACCTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 26, 4: 262}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!