ID: 935480517_935480524

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 935480517 935480524
Species Human (GRCh38) Human (GRCh38)
Location 2:103582458-103582480 2:103582505-103582527
Sequence CCTAGATGAAAGGGCCCAACTTG GATTCATTGCATAAATTAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 145} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!