ID: 935562562_935562564

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 935562562 935562564
Species Human (GRCh38) Human (GRCh38)
Location 2:104574260-104574282 2:104574275-104574297
Sequence CCCTGGAGCATTGGAATGGATAA ATGGATAAGTAGAAAGTGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 128} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!