ID: 935588789_935588800

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 935588789 935588800
Species Human (GRCh38) Human (GRCh38)
Location 2:104826054-104826076 2:104826081-104826103
Sequence CCCTCCCCTCCACCCCACAAACT CACCACCCAGAGCTGTAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 11, 3: 150, 4: 1179} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!