ID: 935614687_935614690

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 935614687 935614690
Species Human (GRCh38) Human (GRCh38)
Location 2:105065016-105065038 2:105065043-105065065
Sequence CCCCTATATTTGAGACTATGTAT CTGTCTCCACTGATAGAATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 249} {0: 1, 1: 0, 2: 1, 3: 30, 4: 202}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!