ID: 935627307_935627312

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 935627307 935627312
Species Human (GRCh38) Human (GRCh38)
Location 2:105181706-105181728 2:105181746-105181768
Sequence CCAAGCATGGGATTTGGAGACCA ATGTATTAGCTGTGTGATTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 306} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!