ID: 935640064_935640073

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 935640064 935640073
Species Human (GRCh38) Human (GRCh38)
Location 2:105281849-105281871 2:105281881-105281903
Sequence CCTGGAGACAATTTTATCATGAC GGTGTGCTATGGCATCTAGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 138} {0: 1, 1: 0, 2: 6, 3: 18, 4: 107}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!