ID: 935644483_935644487

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 935644483 935644487
Species Human (GRCh38) Human (GRCh38)
Location 2:105322959-105322981 2:105322976-105322998
Sequence CCCAATCAACCAGTCAGGATGCT GATGCTGGTGCCATATAATTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 120} {0: 1, 1: 0, 2: 0, 3: 11, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!