ID: 935645318_935645336

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 935645318 935645336
Species Human (GRCh38) Human (GRCh38)
Location 2:105329644-105329666 2:105329678-105329700
Sequence CCCGCGCCGCCCCGCGGCCTGGG CCGCTCCGGCCCGCGGCTCCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 12, 3: 54, 4: 476} {0: 1, 1: 2, 2: 4, 3: 52, 4: 361}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!