ID: 935645334_935645356

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 935645334 935645356
Species Human (GRCh38) Human (GRCh38)
Location 2:105329677-105329699 2:105329730-105329752
Sequence CCCGCTCCGGCCCGCGGCTCCTG CGTCACGTGGGGCGGCCGCCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 8, 3: 49, 4: 400} {0: 1, 1: 0, 2: 0, 3: 5, 4: 107}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!