ID: 935692624_935692631

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 935692624 935692631
Species Human (GRCh38) Human (GRCh38)
Location 2:105744898-105744920 2:105744921-105744943
Sequence CCGCGGGGATCGTCAGGCCGGAG CCGCGCGGCCGAGCGGGCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 123} {0: 1, 1: 0, 2: 3, 3: 39, 4: 542}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!