ID: 935697583_935697588

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 935697583 935697588
Species Human (GRCh38) Human (GRCh38)
Location 2:105783465-105783487 2:105783508-105783530
Sequence CCTGTCTGAGCCAGACTTAGCTC GGAAGCTTCGTACACCACCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 135} {0: 1, 1: 0, 2: 0, 3: 11, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!