ID: 935724478_935724487

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 935724478 935724487
Species Human (GRCh38) Human (GRCh38)
Location 2:106011073-106011095 2:106011124-106011146
Sequence CCTGTTTCCCTTTTTTCCCAATA TCCACGAGCCTAATTTTTCATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 18, 3: 139, 4: 381}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!