ID: 935730355_935730364

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 935730355 935730364
Species Human (GRCh38) Human (GRCh38)
Location 2:106060016-106060038 2:106060050-106060072
Sequence CCGTTGTTTAGGCAGTTTTCGGG CAGGGTTCTCCCTCTGTAGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 18, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!