ID: 935731849_935731859

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 935731849 935731859
Species Human (GRCh38) Human (GRCh38)
Location 2:106070793-106070815 2:106070844-106070866
Sequence CCCTGGAGCCTGTCCATGGAAGG GTCACCATTACCTCCATCCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 20, 4: 215} {0: 1, 1: 0, 2: 1, 3: 10, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!