ID: 935735296_935735305

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 935735296 935735305
Species Human (GRCh38) Human (GRCh38)
Location 2:106101963-106101985 2:106101991-106102013
Sequence CCTTCTCCTCCTCCATCGTTACC GGAGCAGGTCACTCTGGGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 56, 4: 742} {0: 1, 1: 0, 2: 2, 3: 10, 4: 274}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!