ID: 935735297_935735304

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 935735297 935735304
Species Human (GRCh38) Human (GRCh38)
Location 2:106101969-106101991 2:106101986-106102008
Sequence CCTCCTCCATCGTTACCAGTGAG AGTGAGGAGCAGGTCACTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 83} {0: 1, 1: 0, 2: 1, 3: 20, 4: 221}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!