ID: 935765744_935765750

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 935765744 935765750
Species Human (GRCh38) Human (GRCh38)
Location 2:106366274-106366296 2:106366307-106366329
Sequence CCCTGAGGCTGCAGCAGAGCACG TGTGCAGAGCTCAGGTTGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 245} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!