ID: 935778332_935778339

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 935778332 935778339
Species Human (GRCh38) Human (GRCh38)
Location 2:106491054-106491076 2:106491102-106491124
Sequence CCGCAAAAGGGACTATCCACGGT CTGTGTTTCGGGATGCAAGCCGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 4, 4: 41} {0: 2, 1: 0, 2: 0, 3: 7, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!