ID: 935782981_935782984

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 935782981 935782984
Species Human (GRCh38) Human (GRCh38)
Location 2:106524270-106524292 2:106524293-106524315
Sequence CCATTGTCCCTTTGTATATTCAT GCTCTTGTTTCTGATGCCCGAGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 22, 3: 98, 4: 493} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!