ID: 935832828_935832830

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 935832828 935832830
Species Human (GRCh38) Human (GRCh38)
Location 2:107018533-107018555 2:107018570-107018592
Sequence CCTGCATGGGTTGGTGGAAGTTT GATAATGCACATAAGGCTCTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 39, 4: 187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!