ID: 935847692_935847696

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 935847692 935847696
Species Human (GRCh38) Human (GRCh38)
Location 2:107184706-107184728 2:107184729-107184751
Sequence CCCTGTATCACCAATAACAGGAT GTTCCTTTCCTCTGAATATAGGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 22, 3: 71, 4: 325}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!