ID: 935898094_935898099

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 935898094 935898099
Species Human (GRCh38) Human (GRCh38)
Location 2:107759428-107759450 2:107759477-107759499
Sequence CCACCTTTTCGTTTGTGTTTCAG TTCTAACCCCATGAGCTACAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!