|
Left Crispr |
Right Crispr |
| Crispr ID |
935996382 |
935996389 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:108778814-108778836
|
2:108778850-108778872
|
| Sequence |
CCTCCTGGGCTCTAAAGCAATCC |
TCCCAAGTAGCTGGGACCACAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 6, 3: 40, 4: 157} |
{0: 4135, 1: 51604, 2: 165139, 3: 224358, 4: 223435} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|