|
Left Crispr |
Right Crispr |
| Crispr ID |
935996407 |
935996413 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:108778971-108778993
|
2:108778986-108779008
|
| Sequence |
CCTGCCACCTTGGCCTTGCACAG |
TTGCACAGTGCTGGGATTGTAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 2, 2: 62, 3: 1759, 4: 29958} |
{0: 1, 1: 1, 2: 103, 3: 3322, 4: 55322} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|