|
Left Crispr |
Right Crispr |
Crispr ID |
935996407 |
935996414 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
2:108778971-108778993
|
2:108779005-108779027
|
Sequence |
CCTGCCACCTTGGCCTTGCACAG |
TAGGCATGAGCCACTGCACCTGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 2, 2: 62, 3: 1759, 4: 29958} |
{0: 816, 1: 9554, 2: 33163, 3: 80351, 4: 135947} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|